Cookie preferences
This website uses cookies, which are necessary for the technical operation of the website and are always set. Other cookies, which increase the comfort when using this website, are used for direct advertising or to facilitate interaction with other websites and social networks, are only set with your consent.
Configuration
Technically required
These cookies are necessary for the basic functions of the shop.
"Allow all cookies" cookie
"Decline all cookies" cookie
CSRF token
Cookie preferences
Currency change
Customer-specific caching
FACT-Finder tracking
Individual prices
Selected shop
Session
Comfort functions
These cookies are used to make the shopping experience even more appealing, for example for the recognition of the visitor.
Note
Show the facebook fanpage in the right blod sidebar
Statistics & Tracking
Affiliate program
Conversion and usertracking via Google Tag Manager
Track device being used
| Item number | Size | Datasheet | Manual | SDS | Delivery time | Quantity | Price |
|---|---|---|---|---|---|---|---|
| BPS-82122 | 1 ml (500 µl x 2) | - | - |
3 - 15 business days* |
1,389.00€
|
If you have any questions, please use our Contact Form.
You can also order by e-mail: info@biomol.com
Larger quantity required? Request bulk
You can also order by e-mail: info@biomol.com
Larger quantity required? Request bulk
The NLRP3 shRNA Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral... more
Product information "NLRP3 Human shRNA Lentivirus"
The NLRP3 shRNA Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain 3 shRNAs (Short hairpin RNA) targeting human NLRP3 driven by a U6 promoter, and a puromycin selection marker (Figures 1). The sequences of the shRNA used are shown. List of shRNA sequences present in the NLRP3 shRNA Lentivirus. Gene Target NLRP3 GAGACTCAGGAGTCGCAATTT NLRP3 GGCTGTAACATTCGGAGATTG NLRP3 TCATCATTCCCGCTATCTTTC
| Keywords: | CLR1.1, Cryopyrin, Caterpiller protein 1.1, PYRIN-containing APAF1-like protein 1, Angiotensin/vasopressin receptor AII/AVP-like, NACHT, LRR and PYD domains-containing protein 3, Cold-induced autoinflammatory syndrome 1 protein, |
| Supplier: | BPS Bioscience |
| Supplier-Nr: | 82122 |
Properties
| Application: | NLRP3 knockdown cell pool / cell line generation (puromycin selection/limiting dilution) |
| Species reactivity: | human |
Database Information
| KEGG ID : | K12800 | Matching products |
| UniProt ID : | Q96P20 | Matching products |
| Gene ID | GeneID 114548 | Matching products |
Handling & Safety
| Storage: | -80°C |
| Shipping: | -80°C (International: °C) |
Caution
Our products are for laboratory research use only: Not for administration to humans!
Our products are for laboratory research use only: Not for administration to humans!
You will get a certificate here
Viewed