Cookie preferences
This website uses cookies, which are necessary for the technical operation of the website and are always set. Other cookies, which increase the comfort when using this website, are used for direct advertising or to facilitate interaction with other websites and social networks, are only set with your consent.
Configuration
Technically required
These cookies are necessary for the basic functions of the shop.
"Allow all cookies" cookie
"Decline all cookies" cookie
CSRF token
Cookie preferences
Currency change
Customer-specific caching
FACT-Finder tracking
Individual prices
Selected shop
Session
Comfort functions
These cookies are used to make the shopping experience even more appealing, for example for the recognition of the visitor.
Note
Show the facebook fanpage in the right blod sidebar
Statistics & Tracking
Affiliate program
Conversion and usertracking via Google Tag Manager
Track device being used
Item number | Size | Datasheet | Manual | SDS | Delivery time | Quantity | Price |
---|---|---|---|---|---|---|---|
N2304.500 | 500 ng | - | - |
3 - 19 business days* |
644.00€
|
If you have any questions, please use our Contact Form.
You can also order by e-mail: info@biomol.com
Larger quantity required? Request bulk
You can also order by e-mail: info@biomol.com
Larger quantity required? Request bulk
GTTGAGGGGACTTTCCCAGGC (top strand only KB consensus site in bold).||NFkB was originally... more
Product information "NFkB, Consensus Oligonucleotide (Nuclear Factor kappa B)"
GTTGAGGGGACTTTCCCAGGC (top strand only KB consensus site in bold). NFkB was originally identified as a factor that binds to the immunoglobulin kappa light chain enhancer in B cells. It was subsequently found in non-B cells in an inactive cytoplasmic form consisting of NFkB bound to IkB. NF-kB was originally identified as a heterodimeric DNA binding protein complex consisting of p65 (RelA) and p50 (NFKB1) subunits. Other identified subunits include p52, c-Rel, and RelB. The p65, cRel, and RelB subunits are responsible for transactivation. The p50 and p52 subunits possess DNA binding activity but limited ability to transactivate. p52 has been reported to form transcriptionally active heterodimers with the NFkB, subunit p65, similar to p50/p65 heterodimers. The heterodimers of p52/p65 and p50/p65 are regulated by physical inactivation in the cytoplasm by an inhibitor called IkB-a. IkB-a binds to the p65 subunit, preventing nuclear localization and DNA binding. Low levels of p52 and p50 homodimers can also exist in cells. Applications: Suitable for use in Shift and Super Shift Assays. Other applications not tested. Recommended Dilution: Optimal dilutions to be determined by the researcher. Storage and Stability: For long-term storage, aliquot to avoid repeated freezing and thawing and freeze at -70°C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap. Aliquots are stable for at least 12 months.
Supplier: | United States Biological |
Supplier-Nr: | N2304 |
Properties
Application: | Dot Blot |
Database Information
Handling & Safety
Storage: | -80°C |
Shipping: | -20°C (International: -20°C) |
Caution
Our products are for laboratory research use only: Not for administration to humans!
Our products are for laboratory research use only: Not for administration to humans!
You will get a certificate here
Viewed