TGFBR2 CRISPR/Cas9 Lentivirus (Non-Integrating)

Transforming growth factor beta receptor 2 (TGFBR2) encodes the TGF-beta receptor protein, a transmembrane protein that forms a heterodimeric complex with other receptor proteins and binds TGF-beta. This receptor/ligand complex phosphorylates proteins which regulate cell proliferation, cell cycle arrest, wound healing, and immunosuppression. Mutations in TGFBR2 have been linked with Marfan syndrome and the development of various types of tumors. The TGFBR2 CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based VSV-G pseudotyped lentiviral particles ready to infect most types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1a promoter, along with 5 sgRNA (single guide RNA) targeting human TGFBR2. The TGFRBR2 CRISPR/Cas9 non-integrating lentivirus is made with a mutated integrase, resulting in only transient expression of Cas9 and sgRNA. Although using the non-integrating lentivirus results in lower knockdown efficiency, the Cas9 protein is not permanently expressed, which lowers the risk of off-targeting, and there are no random integrations into the cell's genome. Despite transient expression of Cas9 and sgRNA, knockout cell lines can still be generated using cell sorting or limiting dilution due to the permanent changes in the genomic DNA from the Cas9 nuclease activity and NHEJ repair. Gene Target: sgRNA Sequence: TGFBR2-1-F ACAGTGATCACACTCCATGT TGFBR2-2-F TATCATGTCGTTATTAACTG TGFBR2-3-F GCAGAAGCTGAGTTCAACCT TGFBR2-4-F AAAGCGACCTTTCCCCACCA TGFBR2-5-F ACCTACAGGAGTACCTGACG