TGFBR2 CRISPR/Cas9 Lentivirus (Integrating)

Transforming growth factor receptor beta 2 (TGFBR2) encodes the TGF-beta receptor protein, which is a transmembrane protein that forms a heterodimeric complex with other receptor proteins and binds TGF-beta. This receptor/ligand complex phosphorylates proteins which regulate cell proliferation, cell cycle arrest, wound healing, and immunosuppression. Mutations in TGFBR2 have been linked with Marfan syndrome and the development of various types of tumors. The TGFBR2 CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based VSV-G pseudo-typed lentiviral particles ready to infect most types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1a promoter, along with 5 sgRNA (single guide RNA) targeting human TGFBR2. The DNA transduced by this lentivirus integrates randomly into the cellular genome to express both Cas9 and sgRNA. Puromycin selection increases the knockout efficiency by forcing high expression levels of both Cas9 and the sgRNA, and can be used with the integrating lentivirus to quickly and easily achieve high knockdown efficiencies in a cell pool. Knockdown efficiency is dependent on cell type. Gene Target: sgRNA Sequence: TGFBR2-1-F ACAGTGATCACACTCCATGT TGFBR2-2-F TATCATGTCGTTATTAACTG TGFBR2-3-F GCAGAAGCTGAGTTCAACCT TGFBR2-4-F AAAGCGACCTTTCCCCACCA TGFBR2-5-F ACCTACAGGAGTACCTGACG