FCGR2A CRISPR/Cas9 Lentivirus (Integrating)

Fc Gamma Receptor 2A (also known as CD32A, Fc-gamma-RIIa, FcgRIIa) is a low affinity Fc receptor for immunoglobulin G, encoded by the FCGR2A gene. Fc Gamma Receptor 2A is a cell surface receptor that is expressed on a variety of immune cells such as macrophages and neutrophils. It is involved in phagocytosis and in the clearing of spent immune complexes from the circulation. A polymorphism in FCGR2A has been associated with increased risks of nephritis and lupus. The FCGR2A CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based VSV-G pseudo-typed lentiviral particles that are ready to transduce into almost all types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1a promoter, along with 5 sgRNA (single guide RNA) targeting human FCGR2A . Gene Target: sgRNA Sequence: FCGR2A-1-F TGGAGCACGTTGATCCACGG FCGR2A-2-F AGGGAGAAACCATCATGCTG FCGR2A-3-F GCTTGTGGGATGGAGAAGGT FCGR2A-4-F AGCAGCAGCAAAACTGTCAA FCGR2A-5-F AAAGCACAGTCAGATGCACA