Cookie preferences
This website uses cookies, which are necessary for the technical operation of the website and are always set. Other cookies, which increase the comfort when using this website, are used for direct advertising or to facilitate interaction with other websites and social networks, are only set with your consent.
Configuration
Technically required
These cookies are necessary for the basic functions of the shop.
"Allow all cookies" cookie
"Decline all cookies" cookie
CSRF token
Cookie preferences
Currency change
Customer-specific caching
FACT-Finder tracking
Individual prices
Selected shop
Session
Comfort functions
These cookies are used to make the shopping experience even more appealing, for example for the recognition of the visitor.
Note
Show the facebook fanpage in the right blod sidebar
Statistics & Tracking
Affiliate program
Conversion and usertracking via Google Tag Manager
Track device being used
| Item number | Size | Datasheet | Manual | SDS | Delivery time | Quantity | Price |
|---|---|---|---|---|---|---|---|
| BPS-78894 | 1 ml (500 µl x 2) | - | - |
3 - 8 business days* |
1,307.00€
|
If you have any questions, please use our Contact Form.
You can also order by e-mail: info@biomol.com
Larger quantity required? Request bulk
You can also order by e-mail: info@biomol.com
Larger quantity required? Request bulk
The BCMA CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based, VSV-G pseudo-typed... more
Product information "BCMA CRISPR/Cas9 Lentivirus (Non-Integrating)"
The BCMA CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based, VSV-G pseudo-typed lentiviral particles that are ready to transduce most mammalian cells, including primary and non-dividing cells. These viruses contain a CRISPR/Cas9 gene, driven by an EF1A promoter, and with 5 sgRNA (single guide RNA) targeting human BCMA (B- cell maturation antigen) driven by a U6 promoter. Simultaneous expression of Cas9 and BCMA sgRNA allows the generation of BCMA-knockout cells with one single transduction step. The lentiviruses also contain a puromycin selection marker. The non-integrating lentivirus is made with a mutated integrase, resulting in only transient expression of Cas9 and sgRNA. Although using the non-integrating lentivirus results in lower knockdown efficiency, Cas9 is not permanently expressed, which lowers the risk of off-targeting, and there are no random integrations into the cell's genome. Despite transient expression of Cas9 and sgRNA, knockout cell lines can still be generated using cell sorting or limiting dilution due to the permanent changes in the genomic DNA from the Cas9 nuclease activity and NHEJ repair. Table 1: List of sgRNA Sequences in the BCMA CRISPR/Cas9 Lentivirus. Target: TNFRSF17 (BCMA) Primer ID: sgRNA Sequence: TNFRSF17-1 CCTCTAACATGTCAGCGTTA TNFRSF17-2 TGTCAACTTCGATGTTCTTC TNFRSF17-3 CGAGTACACGGTGGAAGAAT TNFRSF17-4 TTCACTGAATTGGTCACACC TNFRSF17-5 GTGTTTTTAAACTCGTCCTT Note: Puromycin selection should not be used for more than 48 hours post-transduction, which may lower knockout efficiency.
| Keywords: | BCM, CD269, TNFRSF17, B-cell maturation protein, Tumor necrosis factor receptor superfamily member 17, |
| Supplier: | BPS Bioscience |
| Supplier-Nr: | 78894 |
Properties
| Application: | BCMA knock-out/BMCA knock-out cell pool generation, stable BCMA knock-out cell line generation |
| Species reactivity: | human |
Database Information
| KEGG ID : | K05153 | Matching products |
| UniProt ID : | Q02223 | Matching products |
| Gene ID : | GeneID 608 | Matching products |
Handling & Safety
| Storage: | -80°C (avoid repeat freezing and thawing cycles) |
| Shipping: | -80°C (International: °C) |
Caution
Our products are for laboratory research use only: Not for administration to humans!
Our products are for laboratory research use only: Not for administration to humans!
You will get a certificate here
Viewed