No results were found for the filter!
Tissue cDNA, First Strand, Monkey (Cynomolgus) Adult...
Item number: T5595-0534R3.40
BioGenomics(TM) Tissue cDNA: cDNA is supplied as First Strand, Multiple Tissue Panels, and Matched Pairs. PCR-ready First Strand cDNA is tissue specific and are ready-to-use for gene discovery or expression analysis. Over 350 cDNAs from human adult and fetal normal tissues, human diseased and tumor tissues, rat,...
1,360.00€
*
Tissue, cDNA, First Strand, Mouse Adult Normal, Brain
Item number: T5595-0663.40
BioGenomics(TM) Tissue cDNA: cDNA is supplied as First Strand, Multiple Tissue Panels, and Matched Pairs. PCR-ready First Strand cDNA is tissue specific and are ready-to-use for gene discovery or expression analysis. Over 350 cDNAs from human adult and fetal normal tissues, human diseased and tumor tissues, rat,...
1,020.00€
*
Tissue, Total RNA, Mouse, Adult Normal, Stomach
Item number: T5595-7209.50
Total RNAs are available from almost 200 different human adult and fetal normal tissues, human diseased and tumor tissues, as well as mouse, rat, and monkey tissues. Total RNAs are provided ready-to-use for Northern blotting, cDNA synthesis, RNA protection, and RNA differential display. , Total RNA isolation is...
698.00€
*
Tissue, Total RNA, Human Adult Normal, Placenta
Item number: T5595-7367.50
Total RNAs are available from almost 200 different human adult and fetal normal tissues, human diseased and tumor tissues, as well as mouse, rat, and monkey tissues. Total RNAs are provided ready-to-use for Northern blotting, cDNA synthesis, RNA protection, and RNA differential display. , Total RNA isolation is...
775.00€
*
Tissue, Total RNA, Rat Adult Normal, Stomach
Item number: T5595-7995.50
Total RNAs are available from almost 200 different human adult and fetal normal tissues, human diseased and tumor tissues, as well as mouse, rat, and monkey tissues. Total RNAs are provided ready-to-use for Northern blotting, cDNA synthesis, RNA protection, and RNA differential display. , Total RNA isolation is...
809.00€
*
NFKB Oligonucleotide
Item number: K-025
| Keywords: | NF-kappaB NFkappaB NF-kB |
| Application: | ELISA, EMSA, WB |
147.00€
*
Non-CpG DNA, Rabbit
Item number: C7905-88.200
ODN 2041 is a prototype of non-CpG oligodeoxynucleotides (ODN) that is not able to stimulate rabbit PBMC in vitro. The vertebrate immune system has evolved innate immune defense pattern recognition receptors (PRRs) that detect unmethylated cytosine-phosphate-guanine (CpG) motifs within bacterial DNA. Cellular...
| Application: | ELISA |
1,254.00€
*
DNA, Salmon Testes Denatured, 5mg/ml (Deoxyribonucleic...
Item number: D3955.10
Prepared from purified salmon testes DNA, by mechanical shearing and heat denaturation to an average fragment size of 200-1000 base pairs. Recommended Concentration: 100ug/ml. Heat in boiling water for 5 minutes, then cool immediately in ice bath. Handling: To reverse any renaturation occurring during storage,...
| CAS | 9007-49-2 |
492.00€
*
NFkB, Consensus Oligonucleotide (Nuclear Factor kappa B)
Item number: N2304.500
GTTGAGGGGACTTTCCCAGGC (top strand only KB consensus site in bold). NFkB was originally identified as a factor that binds to the immunoglobulin kappa light chain enhancer in B cells. It was subsequently found in non-B cells in an inactive cytoplasmic form consisting of NFkB bound to IkB. NF-kB was originally...
| Application: | Dot Blot |
675.00€
*
Tissue cDNA, First Strand, Human Adult Normal, Brain,...
Item number: T5595-0045.10
BioGenomics(TM) Tissue cDNA: cDNA is supplied as First Strand, Multiple Tissue Panels, and Matched Pairs. PCR-ready First Strand cDNA is tissue specific and are ready-to-use for gene discovery or expression analysis. Over 350 cDNAs from human adult and fetal normal tissues, human diseased and tumor tissues, rat,...
858.00€
*
Tissue, cDNA, First Strand, Monkey (Cynomolgus) Adult...
Item number: T5595-0534N4.40
BioGenomics(TM) Tissue cDNA: cDNA is supplied as First Strand, Multiple Tissue Panels, and Matched Pairs. PCR-ready First Strand cDNA is tissue specific and are ready-to-use for gene discovery or expression analysis. Over 350 cDNAs from human adult and fetal normal tissues, human diseased and tumor tissues, rat,...
| Application: | PCR amplification, Mutation analysis |
1,360.00€
*