MM.1S Cells

Please complete the Material Transfer Agreement (MTA) and submit it along with your order. For all commercial applications, please complete the Intended Use Form.

Item number Size Datasheet Manual SDS Delivery time Quantity Price
CYT-305304 1 each -

3 - 8 business days*

430.00€
 
Categories: Myeloma cell lines Description: The MM.1S cell line is part of the MM.1 series, which... more
Product information "MM.1S Cells"
Categories: Myeloma cell lines Description: The MM.1S cell line is part of the MM.1 series, which was developed from a single patient with multiple myeloma (MM) to study various stages of disease progression and response to glucocorticoid (GC) therapy. MM.1S is specifically sensitive to glucocorticoids, such as dexamethasone, and serves as a model to investigate the mechanisms of GC-induced apoptosis in multiple myeloma cells. This sensitivity makes MM.1S a crucial tool for studying the early phases of MM treatment and the cellular pathways leading to GC responsiveness. MM.1S cells, like other MM.1 lines, exhibit typical myeloma morphology, including round cells with eccentrically located nuclei, many of which are binucleated or multinucleated. These cells express characteristic markers of plasma cells, such as CD38 and PCA-1, while lacking typical B-cell markers like CD19 and CD20, reflecting their terminally differentiated status as plasma cells. They also exhibit high levels of immunoglobulin lambda (lambda) light chain expression, consistent with their origin. This cell line has been vital for exploring pathways of drug action, resistance, and apoptosis in MM, especially in the context of GC treatment. One of the key features of MM.1S is its reliance on functional glucocorticoid receptors (GR) for drug responsiveness. In MM.1S, high levels of wild-type GR enable dexamethasone to induce apoptosis effectively, providing a valuable system for studying the molecular events underlying this process. This line is often compared to its resistant counterpart, MM.1R, to investigate the mechanisms of GC resistance, a critical issue in the treatment of MM. Together, the MM.1S cell line offers insights into drug sensitivity, disease progression, and potential therapeutic strategies for multiple myeloma. Organism: Human Tissue: Peripheral blood Disease: Multiple myeloma Synonyms: MM1.S, MM1-S, MM-1S, MM1S Age: 45 years Gender: Female Ethnicity: African American Morphology: Lymphoblast Cell Type: B cell Growth Properties: Mixed: loosely attached monolayer and suspension Citation: MM.1S (Cytion catalog number 305304) Biosafety Level: 1 Ncbi_ Taxid: 9606.0 Cellosaurus Accession: CVCL_8792 Products: IgA lambda Mutational Profile: Mutation: KRAS, p.Gly12Ala (c.35G>C), heterozygous, Mutation: TRAF3, p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA), homozygous Culture Medium: RPMI 1640, w: 2.0 mM stable Glutamine, w: 2.0 g/L NaHCO3 (Cytion article number 820700a) Supplements: Supplement the medium with 10% heat-inactivated FBS Dissociation Reagent: Accutase Subculturing: Gather the suspension cells in a 15 ml tube and gently wash the adherent cells with PBS lacking calcium and magnesium (use 3-5 ml for T25 flasks and 5-10 ml for T75 flasks). Apply Accutase (1-2 ml for T25 flasks, 2.5 ml for T75 flasks) ensuring full coverage of the cell layer. Allow the cells to incubate at room temperature for 10 minutes. Following incubation, combine and centrifuge both the suspension and adherent cells. After centrifugation, carefully resuspend the cell pellet and transfer the cell suspension into new flasks containing fresh medium. Freeze Medium: As a cryopreservation medium, use complete growth medium (including FBS) + 10% DMSO for adequate post-thaw viability, or CM-1 (Cytion catalog number 800100), which includes optimized osmoprotectants and metabolic stabilizers to enhance recovery and reduce cryo-induced stress. Thawing And Culturing Cells: Confirm that the vial remains deeply frozen upon delivery, as cells are shipped on dry ice to maintain optimal temperatures during transit. Upon receipt, either store the cryovial immediately at temperatures below -150°C to ensure the preservation of cellular integrity, or proceed to step 3 if immediate culturing is required. For immediate culturing, swiftly thaw the vial by immersing it in a 37°C water bath with clean water and an antimicrobial agent, agitating gently for 40-60 seconds until a small ice clump remains. Perform all subsequent steps under sterile conditions in a flow hood, disinfecting the cryovial with 70% ethanol before opening. Carefully open the disinfected vial and transfer the cell suspension into a 15 ml centrifuge tube containing 8 ml of room-temperature culture medium, mixing gently. Centrifuge the mixture at 300 x g for 3 minutes to separate the cells and carefully discard the supernatant containing residual freezing medium. Gently resuspend the cell pellet in 10 ml of fresh culture medium. For adherent cells, divide the suspension between two T25 culture flasks, for suspension cultures, transfer all the medium into one T25 flask to promote effective cell interaction and growth. Adhere to established subculture protocols for continued growth and maintenance of the cell line, ensuring reliable experimental outcomes. Sterility: Mycoplasma contamination is excluded using both PCR-based assays and luminescence-based mycoplasma detection methods. To ensure there is no bacterial, fungal, or yeast contamination, cell cultures are subjected to daily visual inspections. Safety Precautions: When planning to store a cryovial in liquid nitrogen for future thawing, it is mandatory to adhere to stringent safety measures. Appropriate protective gloves and clothing are essential, and the use of a face mask or safety goggles is required during the transfer of frozen samples to or from the liquid nitrogen tank. This is to mitigate the risk of injury from potential cryovial explosions upon removal, which can result in the projection of sharp fragments. Warranty: We stand by the promise of delivering products with high cell viability and robust culture performance. To achieve the best results, please make sure you follow the storage and culture instructions detailed in the product information sheet closely. Your adherence to these guidelines is key to success. Subject To Material Transfer Agreements: If you intend to use Cytion cell lines solely for internal research at a single research site, please complete and sign our Material Transfer Agreement (MTA) and submit it along with your order.For any commercial applications - including but not limited to fee-for-service work, quality control testing, product release, diagnostic use, or regulatory studies - please complete the Intended Use Form so we can prepare a suitable agreement tailored to your project.Please note: The MTA applies only to certain cell lines. If this notice and the MTA document appear on a product page, the agreement is applicable. For cell lines not covered by the MTA, no reference to the agreement will be shown. The MTA is not valid for customers in the Americas, China, or Taiwan. Please contact our U.S. entity to receive the appropriate agreement. Required Product 1: 820700a Required Product 3: 860015.0 Required Product 4: 830100.0
Supplier: Cytion
Supplier-Nr: 305304

Properties

Host: Human
Species reactivity: human

Database Information

Handling & Safety

Storage: Liquid nitrogen
Shipping: -80°C (International: -80°C)
Caution
Our products are for laboratory research use only: Not for administration to humans!
You will get a certificate here
or to request a certificate of analysis.
Read, write and discuss reviews... more
Customer review for "MM.1S Cells"
Write a review
or to review a product.
Viewed