Für die Filterung wurden keine Ergebnisse gefunden!
Tissue, Total RNA, Human Adult Normal, Placenta
Artikelnummer: T5595-7367.50
Total RNAs are available from almost 200 different human adult and fetal normal tissues, human diseased and tumor tissues, as well as mouse, rat, and monkey tissues. Total RNAs are provided ready-to-use for Northern blotting, cDNA synthesis, RNA protection, and RNA differential display. , Total RNA isolation is...
688,00 €
Tissue, Total RNA, Rat Adult Normal, Stomach
Artikelnummer: T5595-7995.50
Total RNAs are available from almost 200 different human adult and fetal normal tissues, human diseased and tumor tissues, as well as mouse, rat, and monkey tissues. Total RNAs are provided ready-to-use for Northern blotting, cDNA synthesis, RNA protection, and RNA differential display. , Total RNA isolation is...
727,00 €
NFKB Oligonucleotide
Artikelnummer: K-025
| Schlagworte: | NF-kappaB NFkappaB NF-kB |
| Anwendung: | ELISA, EMSA, WB |
135,00 €
Non-CpG DNA, Rabbit
Artikelnummer: C7905-88.200
ODN 2041 is a prototype of non-CpG oligodeoxynucleotides (ODN) that is not able to stimulate rabbit PBMC in vitro. The vertebrate immune system has evolved innate immune defense pattern recognition receptors (PRRs) that detect unmethylated cytosine-phosphate-guanine (CpG) motifs within bacterial DNA. Cellular...
| Anwendung: | ELISA |
939,00 €
DNA, Salmon Testes Denatured, 5mg/ml (Deoxyribonucleic...
Artikelnummer: D3955.10
Prepared from purified salmon testes DNA, by mechanical shearing and heat denaturation to an average fragment size of 200-1000 base pairs. Recommended Concentration: 100ug/ml. Heat in boiling water for 5 minutes, then cool immediately in ice bath. Handling: To reverse any renaturation occurring during storage,...
| CAS | 9007-49-2 |
350,00 €
NFkB, Consensus Oligonucleotide (Nuclear Factor kappa B)
Artikelnummer: N2304.500
GTTGAGGGGACTTTCCCAGGC (top strand only KB consensus site in bold). NFkB was originally identified as a factor that binds to the immunoglobulin kappa light chain enhancer in B cells. It was subsequently found in non-B cells in an inactive cytoplasmic form consisting of NFkB bound to IkB. NF-kB was originally...
| Anwendung: | Dot Blot |
644,00 €
Tissue cDNA, First Strand, Human Adult Normal, Brain,...
Artikelnummer: T5595-0045.10
BioGenomics(TM) Tissue cDNA: cDNA is supplied as First Strand, Multiple Tissue Panels, and Matched Pairs. PCR-ready First Strand cDNA is tissue specific and are ready-to-use for gene discovery or expression analysis. Over 350 cDNAs from human adult and fetal normal tissues, human diseased and tumor tissues, rat,...
765,00 €
Tissue, cDNA, First Strand, Monkey (Cynomolgus) Adult...
Artikelnummer: T5595-0534N4.40
BioGenomics(TM) Tissue cDNA: cDNA is supplied as First Strand, Multiple Tissue Panels, and Matched Pairs. PCR-ready First Strand cDNA is tissue specific and are ready-to-use for gene discovery or expression analysis. Over 350 cDNAs from human adult and fetal normal tissues, human diseased and tumor tissues, rat,...
| Anwendung: | PCR amplification, Mutation analysis |
1.137,00 €
DNA Calf Thymus, BioAssay (EC 3.1.21.1, Deoxyribonucleic...
Artikelnummer: D3880.1
Specially prepared to be low in protein content but highly polymerized. Suitable as a substrate for deoxyribonuclease. This DNA is an excellent substrate for DNase. A sodium salt, it must be converted by adding magnesium ions to be susceptible to DNase. Low protein and RNA content Characterized by a high...
| CAS | 9007-49-2 |
ab 242,00 €
WM4002 Purified Genomic DNA
Artikelnummer: WM4002-02-0200
Genomic DNA was purified from cells using genomic DNA preparaton kit according to manufacturers instruction. DNA was diluted to 200 ng/µL in TE buffer (0.01 M Tris Chloride, 0.001 M EDTA, pH 7.6). Concentration was determined at A260 using nanodrop ND-1000. DNA was prepared from cell line WM4002. WM4002 is a...
| Anwendung: | Genomic libraries, PCR templates, DNA sequencing, DNA fingerprinting, mutation analysis |
| Wirt: | Human |
| Spezies-Reaktivität: | human |
ab 2.130,00 €
WM1158 Purified Genomic DNA
Artikelnummer: WM1158-02-0200
Genomic DNA was purified from cells using genomic DNA preparaton kit according to manufacturers instruction. DNA was diluted to 200 ng/µL in TE buffer (0.01 M Tris Chloride, 0.001 M EDTA, pH 7.6). Concentration was determined at A260 using nanodrop ND-1000. DNA was prepared from cell line WM1158. WM1158 is a...
| Anwendung: | Genomic libraries, PCR templates, DNA sequencing, DNA fingerprinting, mutation analysis |
| Wirt: | Human |
| Spezies-Reaktivität: | human |
ab 2.130,00 €