CRBN CRISPR/Cas9 Lentivirus (Integrating)

Artikelnummer Größe Datenblatt Manual SDB Lieferzeit Menge Preis
BPS-78517 1 ml (500 µl x 2) - -

3 - 8 Werktage*

1.248,00 €
 
Cereblon (CRBN) forms an E3 ubiquitin ligase complex which is responsible for ubiquitinating... mehr
Produktinformationen "CRBN CRISPR/Cas9 Lentivirus (Integrating)"
Cereblon (CRBN) forms an E3 ubiquitin ligase complex which is responsible for ubiquitinating proteins that regulate various developmental processes. CRBN also binds to Calcium Activated Potassium Channel subunit alpha-1 (KCNMA1) to regulate ion transport. Moreover, mutations in CRBN may play an underlying role in tumor cells acquiring resistance to immunotherapy. The CRBN CRISPR/Cas9 Lentiviruses are replication incompetent, HIV-based VSV-G pseudotyped lentiviral particles that are ready to transduce almost all types of mammalian cells, including primary and non-dividing cells. The particles contain a CRISPR/Cas9 gene driven by an EF1a promoter, along with 5 sgRNA (single guide RNA) targeting human CRBN. The DNA transduced by this lentivirus integrates randomly into the cellular genome to express both Cas9 and sgRNA. Puromycin selection increases the knockout efficiency by forcing high expression levels of both Cas9 and the sgRNA, and can be used with the integrating lentivirus to quickly and easily achieve high knockdown efficiencies in a cell pool. Efficiencies also depend on the cell type. Gene Target: sgRNA Sequence: CRBN ACCAATGTTCATATAAATGG CRBN CTGACTGTGTTCTTAGCTCA CRBN TTACATACTGTATGTGATGT CRBN TTCTAATTGAACTGCAGACA CRBN TCAAGAAACAGCTACGTGAA
Schlagworte: CRBN, AD-006, Protein cereblon,
Hersteller: BPS Bioscience
Hersteller-Nr: 78517

Eigenschaften

Anwendung: Transient CRBN knockdown, stable CRBN knockout cell line generation following puromycin selection
Spezies-Reaktivität: human

Handhabung & Sicherheit

Lagerung: -80°C
Versand: -80°C (International: °C)
Achtung
Nur für Forschungszwecke und Laboruntersuchungen: Nicht für die Anwendung im oder am Menschen!
Hier kriegen Sie ein Zertifikat
oder , um Analysenzertifikate anzufordern.
Bewertungen lesen, schreiben und diskutieren... mehr
Kundenbewertungen für "CRBN CRISPR/Cas9 Lentivirus (Integrating)"
Bewertung schreiben
oder , um eine Produktbewertung abzugeben.
Zuletzt angesehen