NFkB, Consensus Oligonucleotide (Nuclear Factor kappa B)

GTTGAGGGGACTTTCCCAGGC (top strand only KB consensus site in bold). NFkB was originally identified as a factor that binds to the immunoglobulin kappa light chain enhancer in B cells. It was subsequently found in non-B cells in an inactive cytoplasmic form consisting of NFkB bound to IkB. NF-kB was originally identified as a heterodimeric DNA binding protein complex consisting of p65 (RelA) and p50 (NFKB1) subunits. Other identified subunits include p52, c-Rel, and RelB. The p65, cRel, and RelB subunits are responsible for transactivation. The p50 and p52 subunits possess DNA binding activity but limited ability to transactivate. p52 has been reported to form transcriptionally active heterodimers with the NFkB, subunit p65, similar to p50/p65 heterodimers. The heterodimers of p52/p65 and p50/p65 are regulated by physical inactivation in the cytoplasm by an inhibitor called IkB-a. IkB-a binds to the p65 subunit, preventing nuclear localization and DNA binding. Low levels of p52 and p50 homodimers can also exist in cells. Applications: Suitable for use in Shift and Super Shift Assays. Other applications not tested. Recommended Dilution: Optimal dilutions to be determined by the researcher. Storage and Stability: For long-term storage, aliquot to avoid repeated freezing and thawing and freeze at -70°C. For maximum recovery of product, centrifuge the original vial after thawing and prior to removing the cap. Aliquots are stable for at least 12 months.