Nucleic Acids

Nucleic acids, i.e. DNA and RNA directly isolated from certain organisms or organs, can be used in a variety of different experimental settings. Total RNA isolates from different tissues in combination with qPCR or Next Generation Sequencing allow a quantitative and qualitative examination of the gene expression levels in the respective tissue. Additionally this category includes the RNA genomes of phages as well as salmon sperm and calf thymus DNA.

Nucleic acids, i.e. DNA and RNA directly isolated from certain organisms or organs, can be used in a variety of different experimental settings. Total RNA isolates from different tissues in... read more »
Close window
Nucleic Acids

Nucleic acids, i.e. DNA and RNA directly isolated from certain organisms or organs, can be used in a variety of different experimental settings. Total RNA isolates from different tissues in combination with qPCR or Next Generation Sequencing allow a quantitative and qualitative examination of the gene expression levels in the respective tissue. Additionally this category includes the RNA genomes of phages as well as salmon sperm and calf thymus DNA.

3 from 18 pages
No results were found for the filter!
DNA (Lambda Phage) E.Coli W8850 (Lambda C1857S7)
DNA (Lambda Phage) E.Coli W8850 (Lambda C1857S7)

Item number: MB-104-0500

302.00€ *
Review
Non-CpG DNA, Rabbit
Non-CpG DNA, Rabbit

Item number: C7905-88.200

ODN 2041 is a prototype of non-CpG oligodeoxynucleotides (ODN) that is not able to stimulate rabbit PBMC in vitro. The vertebrate immune system has evolved innate immune defense pattern recognition receptors (PRRs) that detect unmethylated cytosine-phosphate-guanine (CpG) motifs within bacterial DNA. Cellular...
Application: ELISA
939.00€ *
Review
DNA, Salmon Testes Denatured, 5mg/ml (Deoxyribonucleic acid sodium salt)
DNA, Salmon Testes Denatured, 5mg/ml (Deoxyribonucleic...

Item number: D3955.10

Prepared from purified salmon testes DNA, by mechanical shearing and heat denaturation to an average fragment size of 200-1000 base pairs. Recommended Concentration: 100ug/ml. Heat in boiling water for 5 minutes, then cool immediately in ice bath. Handling: To reverse any renaturation occurring during storage,...
CAS 9007-49-2
350.00€ *
Review
NFkB, Consensus Oligonucleotide (Nuclear Factor kappa B)
NFkB, Consensus Oligonucleotide (Nuclear Factor kappa B)

Item number: N2304.500

GTTGAGGGGACTTTCCCAGGC (top strand only KB consensus site in bold). NFkB was originally identified as a factor that binds to the immunoglobulin kappa light chain enhancer in B cells. It was subsequently found in non-B cells in an inactive cytoplasmic form consisting of NFkB bound to IkB. NF-kB was originally...
Application: Dot Blot
644.00€ *
Review
Tissue cDNA, First Strand, Human Adult Normal, Brain, Hippocampus, BioGenomics(TM)
Tissue cDNA, First Strand, Human Adult Normal, Brain,...

Item number: T5595-0045.10

BioGenomics(TM) Tissue cDNA: cDNA is supplied as First Strand, Multiple Tissue Panels, and Matched Pairs. PCR-ready First Strand cDNA is tissue specific and are ready-to-use for gene discovery or expression analysis. Over 350 cDNAs from human adult and fetal normal tissues, human diseased and tumor tissues, rat,...
765.00€ *
Review
Tissue, cDNA, First Strand, Monkey (Cynomolgus) Adult Normal, Prostate
Tissue, cDNA, First Strand, Monkey (Cynomolgus) Adult...

Item number: T5595-0534N4.40

BioGenomics(TM) Tissue cDNA: cDNA is supplied as First Strand, Multiple Tissue Panels, and Matched Pairs. PCR-ready First Strand cDNA is tissue specific and are ready-to-use for gene discovery or expression analysis. Over 350 cDNAs from human adult and fetal normal tissues, human diseased and tumor tissues, rat,...
Application: PCR amplification, Mutation analysis
1,137.00€ *
Review
DNA Calf Thymus, BioAssay (EC 3.1.21.1, Deoxyribonucleic acid sodium salt)
DNA Calf Thymus, BioAssay (EC 3.1.21.1, Deoxyribonucleic...

Item number: D3880.1

Specially prepared to be low in protein content but highly polymerized. Suitable as a substrate for deoxyribonuclease. This DNA is an excellent substrate for DNase. A sodium salt, it must be converted by adding magnesium ions to be susceptible to DNase.  Low protein and RNA content  Characterized by a high...
CAS 9007-49-2
From 242.00€ *
Review
WM1158 Purified Genomic DNA
WM1158 Purified Genomic DNA

Item number: WM1158-02-0200

Genomic DNA was purified from cells using genomic DNA preparaton kit according to manufacturers instruction. DNA was diluted to 200 ng/µL in TE buffer (0.01 M Tris Chloride, 0.001 M EDTA, pH 7.6). Concentration was determined at A260 using nanodrop ND-1000. DNA was prepared from cell line WM1158. WM1158 is a...
Application: Genomic libraries, PCR templates, DNA sequencing, DNA fingerprinting, mutation analysis
Host: Human
Species reactivity: human
From 2,130.00€ *
Review
WM1552C Purified Genomic DNA
WM1552C Purified Genomic DNA

Item number: WM1552C-02-0200

Genomic DNA was purified from cells using genomic DNA preparaton kit according to manufacturers instruction. DNA was diluted to 200 ng/µL in TE buffer (0.01 M Tris Chloride, 0.001 M EDTA, pH 7.6). Concentration was determined at A260 using nanodrop ND-1000. DNA was prepared from cell line WM1552C. WM1552C is a...
Application: Genomic libraries, PCR templates, DNA sequencing, DNA fingerprinting, mutation analysis
Host: Human
Species reactivity: human
From 2,130.00€ *
Review
WM164 Purified Genomic DNA
WM164 Purified Genomic DNA

Item number: WM164-02-0200

Genomic DNA was purified from cells using genomic DNA preparaton kit according to manufacturers instruction. DNA was diluted to 200 ng/µL in TE buffer (0.01 M Tris Chloride, 0.001 M EDTA, pH 7.6). Concentration was determined at A260 using nanodrop ND-1000. DNA was prepared from cell line WM164. WM164 is a...
Application: Genomic libraries, PCR templates, DNA sequencing, DNA fingerprinting, mutation analysis
Host: Human
Species reactivity: human
From 2,130.00€ *
Review
WM1791C Purified Genomic DNA
WM1791C Purified Genomic DNA

Item number: WM1791C-02-0200

Genomic DNA was purified from cells using genomic DNA preparaton kit according to manufacturers instruction. DNA was diluted to 200 ng/µL in TE buffer (0.01 M Tris Chloride, 0.001 M EDTA, pH 7.6). Concentration was determined at A260 using nanodrop ND-1000. DNA was prepared from cell line WM1791C. WM1791C is a...
Application: Genomic libraries, PCR templates, DNA sequencing, DNA fingerprinting, mutation analysis
Host: Human
Species reactivity: human
From 2,130.00€ *
Review
WM1819 Purified Genomic DNA
WM1819 Purified Genomic DNA

Item number: WM1819-02-0200

Genomic DNA was purified from cells using genomic DNA preparaton kit according to manufacturers instruction. DNA was diluted to 200 ng/µL in TE buffer (0.01 M Tris Chloride, 0.001 M EDTA, pH 7.6). Concentration was determined at A260 using nanodrop ND-1000. DNA was prepared from cell line WM1819. WM1819 is a human...
Application: Genomic libraries, PCR templates, DNA sequencing, DNA fingerprinting, mutation analysis
Host: Human
Species reactivity: human
From 2,130.00€ *
Review
3 from 18 pages