Cookie preferences
This website uses cookies, which are necessary for the technical operation of the website and are always set. Other cookies, which increase the comfort when using this website, are used for direct advertising or to facilitate interaction with other websites and social networks, are only set with your consent.
Configuration
Technically required
These cookies are necessary for the basic functions of the shop.
"Allow all cookies" cookie
"Decline all cookies" cookie
CSRF token
Cookie preferences
Currency change
Customer-specific caching
FACT-Finder tracking
Individual prices
Selected shop
Session
Comfort functions
These cookies are used to make the shopping experience even more appealing, for example for the recognition of the visitor.
Note
Show the facebook fanpage in the right blod sidebar
Statistics & Tracking
Affiliate program
Conversion and usertracking via Google Tag Manager
Track device being used
Close filters
Filter by:
No results were found for the filter!
Item number: C7905-88.200
ODN 2041 is a prototype of non-CpG oligodeoxynucleotides (ODN) that is not able to stimulate rabbit PBMC in vitro. The vertebrate immune system has evolved innate immune defense pattern recognition receptors (PRRs) that detect unmethylated cytosine-phosphate-guanine (CpG) motifs within bacterial DNA. Cellular...
Application: | ELISA |
939.00€
*
Item number: D3955.10
Prepared from purified salmon testes DNA, by mechanical shearing and heat denaturation to an average fragment size of 200-1000 base pairs. Recommended Concentration: 100ug/ml. Heat in boiling water for 5 minutes, then cool immediately in ice bath. Handling: To reverse any renaturation occurring during storage,...
CAS | 9007-49-2 |
350.00€
*
Item number: N2304.500
GTTGAGGGGACTTTCCCAGGC (top strand only KB consensus site in bold). NFkB was originally identified as a factor that binds to the immunoglobulin kappa light chain enhancer in B cells. It was subsequently found in non-B cells in an inactive cytoplasmic form consisting of NFkB bound to IkB. NF-kB was originally...
Application: | Dot Blot |
644.00€
*
Item number: T5595-0045.10
BioGenomics(TM) Tissue cDNA: cDNA is supplied as First Strand, Multiple Tissue Panels, and Matched Pairs. PCR-ready First Strand cDNA is tissue specific and are ready-to-use for gene discovery or expression analysis. Over 350 cDNAs from human adult and fetal normal tissues, human diseased and tumor tissues, rat,...
765.00€
*
Item number: T5595-0534N4.40
BioGenomics(TM) Tissue cDNA: cDNA is supplied as First Strand, Multiple Tissue Panels, and Matched Pairs. PCR-ready First Strand cDNA is tissue specific and are ready-to-use for gene discovery or expression analysis. Over 350 cDNAs from human adult and fetal normal tissues, human diseased and tumor tissues, rat,...
Application: | PCR amplification, Mutation analysis |
1,137.00€
*
Item number: D3880.1
Specially prepared to be low in protein content but highly polymerized. Suitable as a substrate for deoxyribonuclease. This DNA is an excellent substrate for DNase. A sodium salt, it must be converted by adding magnesium ions to be susceptible to DNase. Low protein and RNA content Characterized by a high...
CAS | 9007-49-2 |
From 242.00€
*
Item number: WM1158-02-0200
Genomic DNA was purified from cells using genomic DNA preparaton kit according to manufacturers instruction. DNA was diluted to 200 ng/µL in TE buffer (0.01 M Tris Chloride, 0.001 M EDTA, pH 7.6). Concentration was determined at A260 using nanodrop ND-1000. DNA was prepared from cell line WM1158. WM1158 is a...
Application: | Genomic libraries, PCR templates, DNA sequencing, DNA fingerprinting, mutation analysis |
Host: | Human |
Species reactivity: | human |
From 2,130.00€
*
Item number: WM1552C-02-0200
Genomic DNA was purified from cells using genomic DNA preparaton kit according to manufacturers instruction. DNA was diluted to 200 ng/µL in TE buffer (0.01 M Tris Chloride, 0.001 M EDTA, pH 7.6). Concentration was determined at A260 using nanodrop ND-1000. DNA was prepared from cell line WM1552C. WM1552C is a...
Application: | Genomic libraries, PCR templates, DNA sequencing, DNA fingerprinting, mutation analysis |
Host: | Human |
Species reactivity: | human |
From 2,130.00€
*
Item number: WM164-02-0200
Genomic DNA was purified from cells using genomic DNA preparaton kit according to manufacturers instruction. DNA was diluted to 200 ng/µL in TE buffer (0.01 M Tris Chloride, 0.001 M EDTA, pH 7.6). Concentration was determined at A260 using nanodrop ND-1000. DNA was prepared from cell line WM164. WM164 is a...
Application: | Genomic libraries, PCR templates, DNA sequencing, DNA fingerprinting, mutation analysis |
Host: | Human |
Species reactivity: | human |
From 2,130.00€
*
Item number: WM1791C-02-0200
Genomic DNA was purified from cells using genomic DNA preparaton kit according to manufacturers instruction. DNA was diluted to 200 ng/µL in TE buffer (0.01 M Tris Chloride, 0.001 M EDTA, pH 7.6). Concentration was determined at A260 using nanodrop ND-1000. DNA was prepared from cell line WM1791C. WM1791C is a...
Application: | Genomic libraries, PCR templates, DNA sequencing, DNA fingerprinting, mutation analysis |
Host: | Human |
Species reactivity: | human |
From 2,130.00€
*
Item number: WM1819-02-0200
Genomic DNA was purified from cells using genomic DNA preparaton kit according to manufacturers instruction. DNA was diluted to 200 ng/µL in TE buffer (0.01 M Tris Chloride, 0.001 M EDTA, pH 7.6). Concentration was determined at A260 using nanodrop ND-1000. DNA was prepared from cell line WM1819. WM1819 is a human...
Application: | Genomic libraries, PCR templates, DNA sequencing, DNA fingerprinting, mutation analysis |
Host: | Human |
Species reactivity: | human |
From 2,130.00€
*